Clincosm LogoSign in Get a demo

Effect of Oryza Sativa l Extract to LPS, ZO-1, and Intestinal Microbiota in Obese Individuals

Sponsor
Hasanuddin University (Other)
Overall Status
Not yet recruiting
CT.gov ID
NCT04827628
Collaborator
(none)
42
Enrollment
1
Location
3
Arms
1.7
Anticipated Duration (Months)
24.6
Patients Per Site Per Month

Study Details

Study Description

Brief Summary

Background :

Obesity prevalence rises among adults and leads to morbidity and mortality due to subsequent inflammation pathway activation. This activation is induced by higher lipid consumption which activates the Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathway and alters the microbiota profile. The Oryza sativa extract contains anthocyanin which possibly affects the microbiota composition and NF-kb pathway which eventually preserves the protective layer and tight junction of the epithelial cells. Therefore it is important to address the impact of this extract on these parameters.

Objective :

To assess the effect of Oryza sativa extract on microbiota profile (Lactobacillus, Firmicutes, Bacteroides, Bifidobacteria, and Escherichia coli), Lipopolysaccharide/ LPS, and the tight epithelial junction (Zonula Occludens-1) among obese adults.

Method:

A two-arm Quasi-Experimental will be conducted, followed by two repeated measurements, at the baseline and 3 weeks after intervention

Hypothesis:

Oryza sativa extract lowers the LPS level, Firmicutes sp, Bacteroides sp, and increases ZO1 protein, Bifidobacteria, and Lactobacillus sp.

Condition or Disease Intervention/Treatment Phase
  • Dietary Supplement: Oryza Sativa Extract
  • Dietary Supplement: Control
 N/A

Detailed Description

Method:

  1. Non Randomized clinical trial with double-blind

  2. Participants will be recruited consecutively

  3. Matching technique will be applied following several variables adjustment

  4. Two-arm of the group participants are the normal group, the obese control group, and the obese intervention group

Sample size calculation:

The difference between two independent means sample size calculation is applied following the elements below:

  1. Type 1 error: 10% b. Power: 80% c. Effect Size: 0.9 (based on changes of LPS value) d.
Dropout rate: 20% e. Hypothesis: Superiority Trial g. The number of participants per group:

14

Intervention :

  1. Extract: Liquid extract of Oryza sativa derived from 10 grams of Oryza sativa fine powder. The powder is mixed with 100 ml ethanol 50% and 0.5 ml of hydrochloric acid (HCl) in 300 C for 2 hours. A supernatant is extracted and evaporated at 35 C and dried and 60 C to remove any dissolving agents. This yields an extract of 624.27 mg.

  2. Anthocyanin level is measured using a spectrophotometer where 20 microliters of extract added to 2 mL Potassium Chloride (KCl) (with pH 1.0) and 2 ml Sodium Acetate (NaCH3COO) (pH 4.5). Absorption of 500 nm and 700 nm waves are measured and calculated using the cyanide-3-glucoside calculation where :

anthocyanin level : (absorbance x 449.2 x dilution factor x 1000) / 26.9

Control

  1. Active comparator using citric acid and sorbitol mixture
Biological sample:
  1. Serum sample preparation :

Participants should undergo fasting for 12 hours. Blood is drawn from the cubital vein to the plain tube and incubated for 30-45 minutes. Centrifugation of sample is done for 15 minutes with 3000 rotation per minute to yield the serum. The supernatant then extracted and stored at -80 C.

  1. Feces primary Polymerase Chain Reaction (PCR) using 100-gram feces. The PCR primer for intestinal microbiota are enlisted below :

  2. Total intestinal microbiota (ACTCCTACGGGAGGCAGCAGT ATTACCGCGGCTGCTGGC),

  3. Firmicutes-Lactobacillus (TACATCCCAACTCCAGAACGAAGCAACAGTACCACGACC)),

  4. Bacteroidetes-Bacteroides fragilis (ATAGCCTTCGAAAGRAAGATCCAGTATCAACTGCAATTTTA),

  5. Actinobacteria-Bifidobacterium (CTCCTGGAAACGGGGTGGGGTGTTCTTCCCGATATCTACA),

  6. Proteobacteria-E.Coli (CATGCCGCGTGTATGAAGAACGGGTAACGTCAATGAGCAAA)

Protection of Human subject according to Helsinki Declaration

  1. Participants are allowed to receive the information of research including purpose, possible intervention, and side effects.

  2. Possible side effect including :

  3. Participants are allowed to withdraw from the study for any reason.

Statistical Analysis Plan

  1. Descriptive statistic of the baseline

  2. The bivariate analysis between all variables and the outcomes

  3. Paired t-test is intended to see the difference between microbiota profile, LPS, and ZO1 within groups

  4. The independent-test to measure the difference in microbiota profile, LPS, and ZO1 value between groups

  5. Alternative statistical test: Linear mixed model to adjust the fixed and random effects.

Study Design

Study Type:
Interventional
Anticipated Enrollment :
42 participants
Allocation:
Non-Randomized
Intervention Model:
Parallel Assignment
Intervention Model Description:
a non-randomized trial is implemented involving three arms consists of an obese group as the intervention and two control groups, people with normal Body Mass Index, and Obese.a non-randomized trial is implemented involving three arms consists of an obese group as the intervention and two control groups, people with normal Body Mass Index, and Obese.
Masking:
Triple (Participant, Care Provider, Outcomes Assessor)
Masking Description:
To blind the participant, the mixture is given in the darker bottle, and placebo is given the artificial taste similar to the intervention group. This adjustment also blinds the care provider. The outcome assessor is blinded from the allocation of the group.
Primary Purpose:
Treatment
Official Title:
Effect of Oryza Sativa l Extract to Serum Lipopolysaccharide, Tight Junction Protein 1 (ZO-1), and Intestinal Microbiota Expression Among Obese Individual
Anticipated Study Start Date :
Apr 10, 2021
Anticipated Primary Completion Date :
May 1, 2021
Anticipated Study Completion Date :
Jun 1, 2021

Arms and Interventions

Arm Intervention/Treatment
Experimental: Obese with Oryza sativa extract

The group with a body mass index of more than 25 kg/m2 that receive the Oryza Sativa Extract

Dietary Supplement: Oryza Sativa Extract
The product is a suspension of 5.6 gram/100 mL given once daily, contains 71.9%, purple in color, range pH 3-5. Stored in the darker bottle. The frequency of administration is once-daily after the meal.
Active Comparator: Obese with control

The group with a body mass index of more than 25 kg/m2 that receive the citric acid and sorbitol mixture

Dietary Supplement: Control
citric acid 0.1g/oz and 1% sorbitol mixture, given once daily after meal
Active Comparator: Normal Body Mass Index

The group with a body mass index of less than 25 kg/m2 that receive the citric acid and sorbitol mixture

Dietary Supplement: Control
citric acid 0.1g/oz and 1% sorbitol mixture, given once daily after meal

Outcome Measures

Primary Outcome Measures

  1. Lipopolysaccharide (LPS) level of Serum [Changes of LPS value from baseline to the last day of intervention (three weeks)]

    Measured using Enzyme-Linked Immunosorbent Assay (ELISA)

  2. Microbiota Level in Stool sample [Changes of Microbiota value from baseline to the last day of intervention (three weeks)]

    Measured using primary PCR of total microbiota, Firmicutes-Lactobacillus, Bacteroidetes-Bacteroides fragilis, Actinobacteria-Bifidobacterium and Proteobacteria-E.Coli

Secondary Outcome Measures

  1. Zonula Occludens 1 (ZO1) serum level [Changes of ZO1 value from baseline to the last day of intervention (three weeks)]

    Measured using Enzyme-Linked Immunosorbent Assay (ELISA)

Eligibility Criteria

Criteria

Ages Eligible for Study:
18 Years to 21 Years
Sexes Eligible for Study:
Male
Accepts Healthy Volunteers:
Yes

Inclusion Criteria

  1. No consumption of the antioxidant supplement

  2. No consumption of prebiotic and probiotic

  3. Currently not undergo specific diet

Exclusion Criteria

  1. Current smoker

  2. Diagnosed with chronic diseases

  3. Patients with altered kidney and liver function

  4. Unable to participate for any reason

Contacts and Locations

Locations

Site City State Country Postal Code
1 Hasanuddin University Medical Research Center / HUMRC Makassar South Sulawesi Indonesia 90245

Sponsors and Collaborators

  • Hasanuddin University

Investigators

  • Principal Investigator: Agussalim Bukhari, Ph.D, Hasanuddin University
  • Principal Investigator: Nurpudji Taslim, Prof., Hasanuddin University
  • Principal Investigator: Aminuddin Aminuddin, Ph.D, Hasanuddin University
  • Principal Investigator: Armanto Makmun, M.Kes, Universitas Muslim Indonesia
  • Principal Investigator: Rachmat Syamsu, M.Kes, Universitas Muslim Indonesia
  • Principal Investigator: Bumi Herman, MD. Ph.D, Chulalongkorn University

Study Documents (Full-Text)

None provided.

More Information

Publications

Responsible Party:
Bumi Herman, Assistant Lecturer, Hasanuddin University
ClinicalTrials.gov Identifier:
NCT04827628
Other Study ID Numbers:
  • 1803211718
First Posted:
Apr 1, 2021
Last Update Posted:
Apr 5, 2021
Last Verified:
Apr 1, 2021
Individual Participant Data (IPD) Sharing Statement:
No
Plan to Share IPD:
No
Studies a U.S. FDA-regulated Drug Product:
No
Studies a U.S. FDA-regulated Device Product:
No
Keywords provided by Bumi Herman, Assistant Lecturer, Hasanuddin University
Lipopolysaccharide
Zonula Occludens 1
Obesity
Oryza sativa
Anthocyanin
Intestinal Microbiota
Additional relevant MeSH terms:
Obesity

Study Results

No Results Posted as of Apr 5, 2021