Clincosm LogoSign in Get a demo

Telomere Length in Relation to Acute Stress Response in Critical Care Patients

Sponsor
Rabin Medical Center (Other)
Overall Status
Completed
CT.gov ID
NCT03982589
Collaborator
(none)
40
Enrollment
1
Location
12
Actual Duration (Months)
3.3
Patients Per Site Per Month

Study Details

Study Description

Brief Summary

the investigators studied the impact of severe stress (in this case any event or illness leading to a necessity of critical care) on telomere length.

Condition or Disease Intervention/Treatment Phase

    Detailed Description

    Telomeres length analysis were determined from 2 blood samples, the initial sample drawn in the first 72 hours after hospitalization and the second after not < 5 or > 14 days. For patients discharged before day 5, a repeat sample was drawn and analyzed on the discharge day. The blood sample processing was as follows: 5 ml of blood was collected and the red blood cells (RBC) were lysed using the RBC lysis solution (Biological Industries, Beit Haemek, Israel). Isolation of genomic DNA was performed by using the DNA isolation kit for mammalian blood (Roche, Mannheim, Germany). Briefly, DNA was isolated by the salting out procedure, washed and precipitated by isopropanol. The DNA was resuspended in polymerase chain reaction (PCR) grade water. The DNA concentration was measured by using the NanoDrop device (Thermo Fisher, USA).

    DNA samples were analyzed for telomere length according to the method of Cawthon (2009) [20] with slight modifications. Each DNA sample was analyzed by two sets of primers detailed below, one for telomere length analysis and one for a reference gene analysis (human hemoglobin). The primers were diluted to 100µM in PCR grade water and then to 10µM. DNA samples were diluted to 2.5 ng/µl in PCR grade water. The primers sequences are shown below:

    telc: TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA telg: ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT hbgd:_GCCCGGCCCGCCGCGCCCGTCCCGCCGGAGGAGAAGTCTGCCGTT hbgu: GGCGGCGGGCGGCGCGGGCTGGGCGGCTTCATCCACGTTCACCTTG

    Reaction PCR were processed as follows:

    50°C for 2 min, 95°C for 5 min, a single cycle of 94°C for 15 sec, 49°C for 15 sec; 40 cycles of: 94°C for 15sec, 62°C for 10 sec and a final stage of: 74°C for 15 sec. All reactions were performed using the Step One device (ABI, USA).

    Study Design

    Study Type:
    Observational [Patient Registry]
    Actual Enrollment :
    40 participants
    Observational Model:
    Cohort
    Time Perspective:
    Prospective
    Official Title:
    Telomere Length in Relation to Acute Stress Response in Critical Care Patients
    Actual Study Start Date :
    Oct 1, 2017
    Actual Primary Completion Date :
    Mar 30, 2018
    Actual Study Completion Date :
    Sep 30, 2018

    Outcome Measures

    Primary Outcome Measures

    1. telomere length difference [7 days]

      the difference between telomere length in percent between samples taken

    Secondary Outcome Measures

    1. correlation between mortality and telomere length [6 month]

      correlation between mortality and telomere length

    2. correlation between telomere length change and leukocytes count change [7 days]

      correlation between telomere length change and leukocytes count change

    Eligibility Criteria

    Criteria

    Ages Eligible for Study:
    18 Years to 75 Years
    Sexes Eligible for Study:
    All
    Accepts Healthy Volunteers:
    No
    Inclusion Criteria:

    • • Patients hospitalized up to 72 hours prior to admission to the ICU

    • Predicted ICU stay is at least 5 days

    Exclusion Criteria:
    • • Pregnancy and lactation

    Contacts and Locations

    Locations

    Site City State Country Postal Code
    1 Rabin medical center Petah Tikva Israel

    Sponsors and Collaborators

    • Rabin Medical Center

    Investigators

    None specified.

    Study Documents (Full-Text)

    None provided.

    More Information

    Publications

    None provided.
    Responsible Party:
    Rabin Medical Center
    ClinicalTrials.gov Identifier:
    NCT03982589
    Other Study ID Numbers:
    • 0319-11-RMC
    First Posted:
    Jun 11, 2019
    Last Update Posted:
    Jun 25, 2019
    Last Verified:
    Jun 1, 2019
    Studies a U.S. FDA-regulated Drug Product:
    No
    Studies a U.S. FDA-regulated Device Product:
    No
    Additional relevant MeSH terms:
    Acute Disease

    Study Results

    No Results Posted as of Jun 25, 2019